In silico Design of sgRNA for CRISPR/Cas9-Mediated MLO Gene Mutagenesis to Reduce Powdery Mildew Susceptibility in Vitis vinifera

Powdery mildew (Erysiphe necator) poses a severe threat to Vitis vinifera (grapevine) cultivation worldwide, causing substantial yield and quality losses. Conventional fungicide-based management raises sustainability concerns and risks of pathogen resistance. The Mildew Locus O (MLO) gene family, which encodes transmembrane proteins functioning as negative regulators of plant immunity, represents a compelling target for durable disease resistance through loss-of-function mutagenesis. This study presents a comprehensive in silico workflow for the design and evaluation of single-guide RNAs (sgRNAs) for CRISPR/Cas9-mediated mutagenesis of VvMLO7 (Accession: EU591726) in grapevine. Using the CHOPCHOP v3 tool, 18 candidate sgRNAs were generated and filtered based on GC content (35–65%), self-complementarity, predicted on-target efficiency, and off-target mismatch scores. Two optimal sgRNAs were selected: sgRNA1 (GTGGGGACACACCATTCGAGTGG; efficiency 65.95%) and sgRNA2 (TCCCGTGTTCACTTATTGCAAGG; efficiency 59.05%). Secondary structure analysis via RNAfold confirmed canonical stem-loop conformations with minimum free energies of −28.60 and −27.40 kcal/mol, respectively. Both sgRNAs were integrated into a pCas9-TPC plant-compatible vector incorporating homology-directed repair (HDR) donor sequences and a GFP selection marker. This in silico framework provides a rational, cost-effective foundation for experimental validation and advances precision breeding approaches for sustainable viticulture