Mallomonas imperatoria E. S. Gusev, Martynenko, Sterlyagova & Ignatenko 2026, sp. nov.

Mallomonas imperatoria E. S. Gusev, Martynenko, Sterlyagova & Ignatenko sp. nov. Figs 3, 4, 5 Description. Cells are elongated, cylindrical to ellipsoidal, 12.6–18.0 × 9.5–12.4 µm, covered with different scale types: body and terminal scales. All scales are thick, with an internal reticulation of closely spaced meshes and an external cover of papillae. Body scales are rhomboidal, slightly asymmetrical, 4.7–5.8 × 2.9–4.0 µm. The posterior rim is wide, encircling approximately half of the scale’s perimeter. The posterior flange is narrow. The shield is thick and raised above the flanges, covered with densely arranged papillae. The papillae are bipartite, consisting of a broad rounded base with a conical, short spine-like structure at the top. One side of the shield (the left) bears a developed rib, while the other side (the right) has a large, rounded depression. The part of the shield adjacent to this large depression lacks papillae. The anterior flange is narrow and smooth. The putative anterior scales are broadly ovate, asymmetrical, 4.6–5.0 × 3.2–3.4 µm, with a wide, rounded, or oval elevation in the distal part. This elevation is covered with papillae. On the shield, the papillae are displaced towards one edge. A large depression is present in the central part of the scale. The putative posterior scales are broadly ovate, 3.4–4.4 × 2.5–3.1 µm, with a prominent ridge of varying degrees of development located in the central part. Papillae cover the apical part of the ridge but are absent from the lateral walls. The scale surface surrounding the ridge is covered with papillae. Stomatocysts are unknown. Type. Vietnam • Sandpit, Cam Ranh Peninsula, Khanh Hoa Province; 12°04.927'N, 109°10.977'E; 25 June 2012; E. S. Gusev leg. Holotype. Portion of a single gathering of cells on SEM stub 74 _ I _ 1, deposited at the Herbarium of the Steppe Institute of the Ural Branch of the Russian Academy of Sciences, Orenburg (ORIS). Fig. 3 С is a representative scale from the type specimen. GenBank accession numbers for the reference culture (VN 814). PX 698440 (nuclear SSU + ITS rDNA) and PX 703656 (rbc L cpDNA). Etymology. The epithet “imperatoria” means “imperial”, referring to the distinctive crown-shaped ridge on the terminal scales. Distribution and ecology. In addition to the type locality, this species has been observed in 21 more localities in Vietnam (Tables 1, 2). Mallomonas imperatoria sp. nov. was found at quite wide ranges of environmental parameters: pH from 5.5 to 7.8, specific conductance from 6 to 100 µS cm - 1, and temperature 25–37 ° C, but it tends to prefer acidic conditions with low mineralized waters (Tables 1, 2). Mallomonas imperatoria sp. nov. (OTU 1 nucleotide sequence, V 9 SSU-ITS 1 rDNA). GCACCTACCGATTGAATGATTCGGTGAAAATTCCGGACTGTGGCTCGGTTGCTTTCGGGCGACTT TGCTGTAGGAAGTTATTTAAACCTCATCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG GTGAACCTGCGGAAGGATCATTACCACAACATCAACCACATTGATATCAACATATCATGCTGGTCC GATTAGCGCAATATAAAATTTAGTTTCTTCCGAAACTTTATTTTACTCCACAAGGATGTGGTATTC TGTTTGAGTGATTTTGGAGATCTCTAATCTCTCCAAACAAGGAGAGACATATGAAATTTCTAAACA CTTTCAGCAACGGATGTCTTGGCTCCCA.