Scytodes tanjiashui Liu 2026, sp. nov.

Scytodes tanjiashui Liu sp. nov. Materials Type status: Holotype. Occurrence: catalogNumber: ASM-JGSU-Ara 6782; recordedBy: Liu Ke-ke; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: FA553227-CA22-5E87-BBA4-EFAC971285B8; Taxon: scientificName: Scytodes tanjiashui sp. nov.; Location: country: China; stateProvince: Jiangxi; locality: Ji'an City, Jinggangshan County Level City, Jinggangshan National Nature Reserve, Longtan Scenic Spot; verbatimElevation: 856 m; verbatimCoordinates: 26°35'45.60"N, 114°8'20.40"E; georeferenceProtocol: GPS; Event: samplingProtocol: sieving; eventDate: 31/5/2014 Type status: Paratype. Occurrence: catalogNumber: ASM-JGSU-Ara 6783; recordedBy: Liu Ke-ke; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 2FA35EF9-2725-56AC-8E4D-2F44E090DD47; Taxon: scientificName: Scytodes tanjiashui sp. nov.; Location: country: China; stateProvince: Jiangxi; locality: Ji'an City, Jinggangshan County Level City, Jinggangshan National Nature Reserve, Longtan Scenic Spot; verbatimElevation: 929 m; verbatimCoordinates: 26°35'31.20"N, 114°8'16.80"E; georeferenceProtocol: GPS; Event: samplingProtocol: sieving; eventDate: 31/5/2014 Type status: Paratype. Occurrence: catalogNumber: ASM-JGSU-Ara 4256; recordedBy: Liu Ke-ke; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 99890955-22E5-56A4-BBE6-897D638CD042; Taxon: scientificName: Scytodes tanjiashui sp. nov.; Location: country: China; stateProvince: Jiangxi; locality: Ji'an City, Jinggangshan County Level City, Jinggangshan National Nature Reserve, Jingzhushan; verbatimElevation: 936 m; verbatimCoordinates: 26°33'15.24"N, 114°7'10.13"E; georeferenceProtocol: GPS; Event: samplingProtocol: sieving; eventDate: 20/5/2025 Type status: Paratype. Occurrence: catalogNumber: ASM-JGSU-Ara 4248; recordedBy: Liu Ke-ke; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 3F227D2D-45E4-509B-BCDC-CADFE2DE26D4; Taxon: scientificName: Scytodes tanjiashui sp. nov.; Location: country: China; stateProvince: Jiangxi; locality: Ji'an City, Jinggangshan County Level City, Jinggangshan National Nature Reserve, Jingzhushan; verbatimElevation: 936 m; verbatimCoordinates: 26°33'15.24"N, 114°7'10.13"E; georeferenceProtocol: GPS; Event: samplingProtocol: sieving; eventDate: 20/5/2025 Description Male (Holotype). Habitus as in Fig. 1 A and B. Total length 4.79. Carapace slightly domed, 2.47 long, 1.91 wide. Clypeus height 0.16. Eye sizes and interdistances: PME 0.11, ALE 0.14, PLE 0.14; PMEs close touching, ALE and PLE close touching, ALE-ALE 0.54, ALE-PME 0.20, PLE-PLE 0.72, PLE-PME 0.34. Lateral eyes on a tubercle. Chelicerae (Fig. 1 B and Fig. 4 A-C) with one lamina on distal cheliceral furrow and four retrolateral marginal teeth. Endites longer than wide, with a claw-like tip and sparse short setae on surface. Labium pear-shaped, wider than long. Sternum oval, longer than wide, anterior margin fused with labium, lateral margin with subtriangular sclerites, directed at the base of coxae, posterior margin blunt, with thick setae on surface. Leg measurements: I 18.98 (5.12, 0.58, 5.40, 7.13, 0.75); II 12.57 (3.61, 0.53, 3.66, 4.08, 0.69); III 7.75 (2.42, 0.53, 2.23, 2.14, 0.43); IV 8.32 (2.26, 0.38, 2.75, 2.44, 0.49). Leg formula: 1243. Abdomen (Fig. 1 A and B) 2.32 long, 1.88 wide, covered with slender hairs. Colouration (Fig. 1 A and B). Carapace yellowish, medially with four long brown stripes and laterally, with three gradually becoming longer brown stripes. Chelicerae pale with dorsal longitudinal brown stripe. Palps yellow with prolateral and dorsal brown spots. Endites yellow, anterior part pale. Labium yellow, yellowish at tip. Sternum pale yellow with yellow margins. Legs orange, femora I – IV with ventral brown transverse stripes. Abdomen cream-coloured with six faint dark brown transverse stripes around the centre. Palp (Fig. 1 C, D and Fig. 4 E-G). Palpal tibia, shorter than cymbium. Cymbium with a slightly swollen base. Bulb 0.40 long, 0.37 wide, embolus 0.81 long, the tip divided into two parts, one handle-shaped sclerotised process and one triangular embolus. Female (Paratype). Colouration pattern as in male. Habitus as in Fig. 2 A, B and Fig. 5 A and B. Total length 5.20. Carapace domed, 2.59 long, 1.97 wide. Eye sizes and interdistances: PME 0.11, ALE 0.13, PLE 0.15; PMEs close touching, ALE and PLE close touching, ALE-ALE 0.54, ALE-PME 0.23, PLE-PLE 0.71, PLE-PME 0.36. Clypeus height 0.18. Leg measurements: I 14.42 (3.91, 0.43, 4.25, 5.14, 0.69); II 9.66 (2.80, 0.48, 2.69, 3.14, 0.55); III 6.84 (2.11, 0.49, 1.88, 1.80, 0.56); IV 8.22 (2.14, 0.38, 3.13, 2.12, 0.45). Abdomen (Fig. 2 B, C and Fig. 4 D) 2.61 long, 2.32 wide, ventroposteriorly with a pair of sac-shaped hooks. Genitalia (Fig. 2 D-F, Fig. 3 A and B). In ventral view, with a pair of large subtriangular positioning ridges, slightly separated by the narrow median septum. In dorsal view, extremely transparent through cuticle, with a rainbow-shaped hyaline ridge extending across the vulva and a pair of ham-like spermathecae, located at the base of the hyaline ridge, adjacently with cap-like, membranous hyaline pocket. Diagnosis The male of Scytodes tanijashui sp. nov. resembles that of S. fusca Walckenaer, 1837 (cf. Fig. 1 A, C, D and Fig. 4 E-G vs. Sampathkumar et al. (2022): fig. 1 A, C and D) in having a long, narrow terminal portion of bulb, but can be easily separated from it by the yellowish abdomen with several paired thin black brown stripes (vs. light grey with several transverse darker bands) and the nearly straight embolic tip (vs. slightly curved). The female of the new species resembles Scytodes florifera Yin & Xu, 2012 in having semi-elliptical hyaline pocket (cf. Fig. 2 D-F vs. Yin et al. (2012): fig. 23 d), but can be distinguished by the chelicerae with four retrolateral marginal teeth (vs. absent), the symmetrical dark brown abdominal stripes (vs. lacking) and the oval spermathecae with a short stalk (vs. finger-like). Distribution Known only from Jiangxi Province, China (Fig. 6). Ecology This is a free-running spider species that is usually found in dark places within broad-leaved forests, such as under stones, under logs and in leaf litter (Fig. 5 A and B). Notes DNA barcode ATATAGACTTCTGGGTGTCCAAAGAATCAGAATAGGTGTTGGTATAGAATGGGGTCTCCTCCTCCGGCGGGGTCGAAGAAGGTGGTGTTGAGGTTGCGGTCTGTTAGTAGTATAGTGATGCCAGCAGCTAGGACTGGGAGAGATAGGAGAAGTAGGACTGCTGTGATTAGGACGGATCAGACGAAGAGGGGCGTTTGGTATTGGGTTATGGCAGGGGGTTTTATATTGATAATTGTTGTGATGAAATTGATGGCCCCTAAGATAGAGGAGACACCTGCTAGGTGTAAGGAGAAGATGGTTAGGTCTACGGAGGCTCCAGGGTGGGAGTAGTTCCCTGCTAAGGGAGGGTAGACTGTTCAACCTGTTCCTGCTCCGGCCTCCACTATAGCAGATGCGAGCAGGAGTAGGAGAGAGGGAGGTAAGAGTCAGAAGCTTATGTTGTTTATGCGGGGAAACGCCATATCGGGGGCACCGATTATTAGGGGAACTAGTCAGTTGCCAAAGCCTCCGATTATGATGGGTATTACTATGAAGAAGATTATTACAAATGCATGGGCTGTGACGATAACGTTGTAGATGTGGTCGTTACCTAGAAGGTTGCCTGGCTGGCCCAGCTCGGCTCGAATAAGGAGGCTTAGAGCTGTGCCTAGGACTCCAGCTCATGCGCCGAATAATAGGTATAGTGTTCCAATGTCCTTATGATTAGTAGAAA (GenBank accession number: PX 961463). TTTCTACTAATCATAAGGACATTGGAAGATTGTATCTATTGTTTGGGGGGTGAGCTGTTATAATAGGGACTGCTATGAGAGTTATTATCCGTATTGAGTTAGGGTCTACTGGAAGTTTGTTAGGTGATGATCATTTATATAATGTTATTGTTACTGCTCATGCTTTAGTGATGATTTTTTTTATAGTGATACCTGTTATAATTGGAGGGTTTGGAAATTGATTAGTTCCTTTAATGTTAGGTGCACCTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTATTACCTTCTTCTTTATCTTTGTTATTAATATCTTCTATAGTTGACAGTGGGGTAGGTGCTGGTTGAACTATTTATCCTCCTTTAGCTAGAGATTTAGGGCATTCTGGAGTTTCTGTTGATTTAGCTATTTTTTCATTACATTTGGCAGGGGCATCGTCGATTATGGGGGCAGTTAATTTTATTACTACTATTATTAATATACGGAGTACTGGTATAAATTTTGATAAGGTTCCTTTGTTTGTTTGGTCTGTTTTAGTAACAGCTGTATTATTATTGTTGTCTTTACCCGTATTAGCTGGGGCTATTACGATACTTTTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTTCTGGGGGAGGAGATCCTGTTCTGTTTCAACATTTATTTTGATTCTTTGGACACCCAGAAGTTTACAT (GenBank accession number: PX 961464).