rCRUX Generated Elas02 Reference Database

Zenodo (CERN European Organization for Nuclear Research) 2026 Dataset Open access

Read full text
Authors: Elizabeth A. Suter
DOI: 10.5281/zenodo.18615524
Cited by: 0

Abstract

rCRUX-generated reference database using NCBI nt blast database downloaded in July 2024. Primer Name: Elas02Gene: mitochondrial 12S rRNALength of Target: 171 Primer Reference: Taberlet, P., Bonin, A., Zinger, L., Coissac, E., 2018. Environmental DNA: For biodiversity research and monitoring. Environmental DNA: For Biodiversity Research and Monitoring, 1–253. Elas02-f, 5’-3’: GTTGGTHAATCTCGTGCCAGCElas02-r, 5’-3’: CATAGTAGGGTATCTAATCCTAGTTTG Default rCRUX parameters were chosen for get_seeds_local() and blast_seeds().

Fields of Study & Subjects

Environmental DNA in Biodiversity Studies Genomics and Phylogenetic Studies Genetic diversity and population structure

Publication details

Journal / source
Zenodo (CERN European Organization for Nuclear Research)
Publication date
11 February 2026
Language
EN
Document type
Dataset